APEG1 cDNA ORF Clone, Human, untagged

Cat: HG12472-G-N

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All APEG1 Reagents

CRO Services

Product recommended


All APEG1 Reagents

APEG1 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
342 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SPEG complex locus.

Plasmid

Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI (5.5kb + 0.34kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

APEG1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

APEG1 cDNA ORF Clone, Human, untagged Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 7139

APEG1 cDNA ORF Clone, Human, untagged Alternative Names

APEG-1 cDNA ORF Clone, Human;APEG1 cDNA ORF Clone, Human;BPEG cDNA ORF Clone, Human;CNM5 cDNA ORF Clone, Human;SPEGalpha cDNA ORF Clone, Human;SPEGbeta cDNA ORF Clone, Human

APEG1 Background Information

Striated muscle preferentially expressed protein kinase, also known as aortic preferentially expressed protein 1, APEG-1, SPEG and KIAA1297, is a protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family. SPEG / APEG-1 contains two fibronectin type-III domains, nine Ig-like (immunoglobulin-like) domains, two protein kinase domains. Isoform 1 of SPEG is preferentially expressed in striated muscle. Non-kinase form such as isoform 3 of SPEG is predominantly expressed in the aorta. Isoform 3 of SPEG appears to be expressed only in highly differentiated ASMC in normal vessel walls and down-regulated in dedifferentiated ASMC. Isoform 3 of SPEG may have a role in regulating the growth and differentiation of arterial smooth muscle cells. Isoform 3 of SPEG is quickly down-regulated in response to vascular injury, when ASMC cells change from a quiescent to a proliferative phenotype.

Full Name
SPEG complex locus
References
  • Hsieh C.-M., et al., 1996, J. Biol. Chem. 271:17354-17359.
  • Manjasetty B.A., et al., 2005, BMC Struct. Biol. 5:21-21.
  • Zhou,Y. et al., 2007, Anal Chem. 79 (15): 5826-37.
  • Greenman C., et al., 2007, Nature. 446:153-158.
  • APEG1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    APEG1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12472-ACGLN
    APEG1 qPCR Primer Pairs, Human HP104801
    info info
    添加购物车成功! 添加购物车失败!