Text Size:AAA

휴먼 SPEG/APEG-1 Gene ORF cDNA clone expression plasmid

  • Human SPEG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
데이터시트리뷰관련제품프로토콜
휴먼 SPEG cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001173476.1
cDNA 크기:342bp
cDNA 설명:Full length Clone DNA of Homo sapiens SPEG complex locus.
유전자 동의어:BPEG, APEG1, APEG-1, SPEGbeta, SPEGalpha
:Human
벡터:pCMV/hygro
Plasmid:pCMV-SPEG
제한 사이트:KpnI + XhoI (5.5kb + 0.34kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SPEG qPCR primers for gene expression analysis, HP104801 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
휴먼 SPEG Gene Plasmid Map
Human SPEG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
휴먼 SPEG/APEG-1 Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
연구배경

Striated muscle preferentially expressed protein kinase, also known as aortic preferentially expressed protein 1, APEG-1, SPEG and KIAA1297, is a protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family. SPEG / APEG-1 contains two fibronectin type-III domains, nine Ig-like (immunoglobulin-like) domains, two protein kinase domains. Isoform 1 of SPEG is preferentially expressed in striated muscle. Non-kinase form such as isoform 3 of SPEG is predominantly expressed in the aorta. Isoform 3 of SPEG appears to be expressed only in highly differentiated ASMC in normal vessel walls and down-regulated in dedifferentiated ASMC. Isoform 3 of SPEG may have a role in regulating the growth and differentiation of arterial smooth muscle cells. Isoform 3 of SPEG is quickly down-regulated in response to vascular injury, when ASMC cells change from a quiescent to a proliferative phenotype.

참고자료
  • Hsieh C.-M., et al., 1996, J. Biol. Chem. 271:17354-17359.
  • Manjasetty B.A., et al., 2005, BMC Struct. Biol. 5:21-21.
  • Zhou,Y. et al., 2007, Anal Chem. 79 (15): 5826-37.
  • Greenman C., et al., 2007, Nature. 446:153-158.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".