After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 SPEG/APEG-1 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human SPEG cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001173476.1
cDNA 크기:342bp
cDNA 설명:Full length Clone DNA of Homo sapiens SPEG complex locus.
유전자 동의어:BPEG, APEG1, APEG-1, SPEGbeta, SPEGalpha
:Human
벡터:pCMV/hygro
Plasmid:pCMV-SPEG
제한 사이트:KpnI + XhoI (5.5kb + 0.34kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human SPEG Gene Plasmid Map
Human SPEG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
휴먼 SPEG/APEG-1 Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
연구배경

Striated muscle preferentially expressed protein kinase, also known as aortic preferentially expressed protein 1, APEG-1, SPEG and KIAA1297, is a protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family. SPEG / APEG-1 contains two fibronectin type-III domains, nine Ig-like (immunoglobulin-like) domains, two protein kinase domains. Isoform 1 of SPEG is preferentially expressed in striated muscle. Non-kinase form such as isoform 3 of SPEG is predominantly expressed in the aorta. Isoform 3 of SPEG appears to be expressed only in highly differentiated ASMC in normal vessel walls and down-regulated in dedifferentiated ASMC. Isoform 3 of SPEG may have a role in regulating the growth and differentiation of arterial smooth muscle cells. Isoform 3 of SPEG is quickly down-regulated in response to vascular injury, when ASMC cells change from a quiescent to a proliferative phenotype.

참고자료
  • Hsieh C.-M., et al., 1996, J. Biol. Chem. 271:17354-17359.
  • Manjasetty B.A., et al., 2005, BMC Struct. Biol. 5:21-21.
  • Zhou,Y. et al., 2007, Anal Chem. 79 (15): 5826-37.
  • Greenman C., et al., 2007, Nature. 446:153-158.
  • Size / Price
    Cat No: HG12472-G-N
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human SPEG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".