ABHD11 cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1
Price:
Size:
Number:

ABHD11 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
519 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human abhydrolase domain containing 11
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.52kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ABHD11 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

More Information About ABHD11

Entrez Gene ID

ABHD11 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

ABHD11 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

PP1226 cDNA ORF Clone, Human; WBSCR21 cDNA ORF Clone, Human

ABHD11 Background Information

ABHD11 (α/β-hydrolase domain containing 11) is a non-annotated enzyme belonging to the family of metabolic serine hydrolases (mSHs).Mammalian alpha/beta hydrolase domain (ABHD) family of proteins have emerged as key regulators of lipid metabolism and are found to be associated with human diseases. Human α/β-hydrolase domain containing protein 11 (ABHD11) has recently been predicted as a potential biomarker for human lung adenocarcinoma.  
Full Name
abhydrolase domain containing 11
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait