ABHD13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

ABHD13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1014 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus abhydrolase domain containing 13.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

ABHD13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

1110065L07Rik cDNA ORF Clone, Mouse; AI463703 cDNA ORF Clone, Mouse; AI788994 cDNA ORF Clone, Mouse

ABHD13 Background Information

Full Name
abhydrolase domain containing 13
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait