alk5 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag

Price:
Size:
Number:

alk5 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag: General Information

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1305 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Canis lupus familiaris transforming growth factor, beta receptor 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

alk5 Background Information

Transforming growth factor, beta receptor I, also known as Transforming growth factor-beta receptor type I , Serine / threonine-protein kinase receptor R4, Activin receptor-like kinase 5, SKR4, ALK-5, and TGFBR1, is a single-pass type I membrane protein which belongs to the protein kinase superfamily and TGFB receptor subfamily. TGFBR1 / ALK-5 is found in all tissues examined. It is most abundant in placenta and least abundant in brain and heart. TGF-beta functions as a tumor suppressor by inhibiting the cell cycle in the G1 phase. Administration of TGF-beta is able to protect against mammary tumor development in transgenic mouse models in vivo. Disruption of the TGF-beta/SMAD pathway has been implicated in a variety of human cancers, with the majority of colon and gastric cancers being caused by an inactivating mutation of TGF-beta RII. On ligand binding, TGFBR1 / ALK-5 forms a receptor complex consisting of two type I I and two type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which auto-phosphorylate, then bind and activate SMAD transcriptional regulators. TGF-beta signaling via TGFBR1 / ALK-5 is not required in myocardial cells during mammalian cardiac development, but plays an irreplaceable cell-autonomous role regulating cellular communication, differentiation and proliferation in endocardial and epicardial cells. Defects in TGFBR1 / ALK-5 are the cause of Loeys-Dietz syndrome type 1A (LDS1A), Loeys-Dietz syndrome type 2A (LDS2A), and aortic aneurysm familial thoracic type 5 (AAT5).
Full Name
transforming growth factor, beta receptor 1
References
  • Seki T, et al. (2006) Nonoverlapping expression patterns of ALK1 and ALK5 reveal distinct roles of each receptor in vascular development. Lab Invest. 86(2): 116-29. et al.
  • Piek E, et al. (1999) TGF-(beta) type I receptor/ALK-5 and Smad proteins mediate epithelial to mesenchymal transdifferentiation in NMuMG breast epithelial cells. J Cell Sci. 112 (24): 4557-68. et al.
  • Dudas M, et al. (2004) Tgf-beta3-induced palatal fusion is mediated by Alk-5/Smad pathway. Dev Biol. 266(1): 96-108.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait