Human respiratory syncytial virus (RSV) (subtype B, strain NH1276) glycoprotein G / RSV-G Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized)

Price:
Size:
Number:

Human respiratory syncytial virus (RSV) (subtype B, strain NH1276) glycoprotein G / RSV-G Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized): General Information

Gene
Species
RSV
RefSeq ORF Size
900 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AFI26215.1.
Description
Full length Clone DNA of Human RSV (subtype B, strain NH1276) Major surface glycoprotein G.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Human respiratory syncytial virus (RSV) (subtype B, strain NH1276) glycoprotein G / RSV-G Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized): Alternative Names

G cDNA ORF Clone, RSV

RSV Glycoprotein G Background Information

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. HRSV G protein is a type II glycoprotein of 289-299 amino acids (depending on the virus strain) with a signal/anchor hydrophobic domain and is extensively modified by the addition of both N-and O-linked oligosaccharides to achieve the mature form of 8-9 kDa. The C-terminal ectodomain of the G protein has a central region and four cysteines which are conserved in all HRSV isolates and have been proposed as the putative receptor binding site. The G protein mediates attachment of the virus to the host cell membrane by interacting with heparan sulfate, initiating the infection. As similar to mucins in amino acid compositions, the RSV G protein can interact with host CX3CR1, the receptor for the CX3C chemokine fractalkine, and thus modulates the immune response and facilitate infection. Secreted glycoprotein G helps RSV escape antibody-dependent restriction of replication by acting as an antigen decoy and by modulating the activity of leukocytes bearing Fcgamma receptors. Unlike the other paramyxovirus attachment proteins, HRSV-G lacks both neuraminidase and hemagglutinating activities.
References
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 : 453-8.
  • Jose AM. et al.,1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73: 6610-7.
  • García-Beato R. et al., 2000, J Gen Virol. 81: 919-27.
  • Zlateva KT. et al., 2004, J Virol. 78: 4675-83.
  • Trento A. et al., 2006, J Virol. 80: 975-84.

RSV Glycoprotein G cDNA ORF Clone, RSV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait