ESAM Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag

Price:
Size:
Number:

ESAM Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1185 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Rattus norvegicus endothelial cell adhesion molecule.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

ESAM Background Information

Endothelial cell-selective adhesion molecule (ESAM) is a member of JAM family of immunoglobulin superfamily and consists of one V-type and one C2-type immunoglobulin domain, as well as a hydrophobic signal sequence, a single transmembrane region, and a cytoplasmic domain. It is specifically expressed at endothelial tight junctions and on activated platelets. ESAM at endothelial tight junctions participates in the migration of neutrophils through the vessel wall, possibly by influencing endothelial cell contacts. The adaptor protein membrane-associated guanylate kinase MAGI-1 has been identified as an intracellular binding partner of ESAM. Previous studies have indicated that ESAM regulates angiogenesis in the primary tumor growth and endothelial permeability. It suggest that ESAM has a redundant functional role in physiological angiogenesis but serves a unique and essential role in pathological angiogenic processes such as tumor growth.
Full Name
endothelial cell adhesion molecule
References
  • Ishida T, et al. (2003) Targeted disruption of endothelial cell-selective adhesion molecule inhibits angiogenic processes in vitro and in vivo. J Biol Chem. 278(36): 34598-604.
  • Wegmann F, et al. (2004) Endothelial adhesion molecule ESAM binds directly to the multidomain adaptor MAGI-1 and recruits it to cell contacts. Exp Cell Res. 300(1): 121-33.
  • Wegmann F, et al. (2006) ESAM supports neutrophil extravasation, activation of Rho, and VEGF-induced vascular permeability. J Exp Med. 203(7): 1671-7.
  • Hara T, et al. (2009) Endothelial cell-selective adhesion molecule regulates albuminuria in diabetic nephropathy. Microvasc Res. 77(3): 348-55.
  • Cangara HM, et al. (2010) Role of endothelial cell-selective adhesion molecule in hematogeneous metastasis. Microvasc Res. 80(1): 133-41.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait