ABHD1 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

ABHD1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1218 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human abhydrolase domain containing 1.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + NotI (6.1kb + 1.22kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ABHD1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ABHD1 cDNA ORF Clone, Human, untagged: Validated Images

ABHD1 cDNA ORF Clone, Human, untagged: Alternative Names

LABH1 cDNA ORF Clone, Human

ABHD1 Background Information

Alpha/beta hydrolase domain containing gene 1 (ABHD1) is a member of the AB hydrolase superfamily and encodes a protein with an alpha/beta hydrolase fold. This domain is common to a number of hydrolytic enzymes of widely differing phylogenetic origins and catalytic functions. .The nine exon human ABHD1 gene is located on chromosome 2p23.3 and encodes a 45-residue protein containing a catalytic triad analogous to that present in serine proteases.ABHD1 was expressed in all tissues and cells examined, but levels of ABHD1 varied greatly, being high in skeletal muscle and testis and low in spleen and fibroblasts.
Full Name
abhydrolase domain containing 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait