CD137 cDNA ORF Clone, Human, C-GFPSpark® tag

1/2
Price:
Size:
Number:

CD137 cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
768 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 8 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.5kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD137 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD137 cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

CD137 cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

4-1BB cDNA ORF Clone, Human; CD137 cDNA ORF Clone, Human; CDw137 cDNA ORF Clone, Human; ILA cDNA ORF Clone, Human

CD137 Background Information

CD137 (also known as 4-1BB) is a surface co-stimulatory glycoprotein originally described as present on activated T lymphocytes, which belongs to the tumor necrosis factor (TNF) receptor superfamily. It is expressed mainly on activated CD4+ and CD8+ T cells, and binds to a high-affinity ligand (4-1BBL) expressed on several antigen-presenting cells such as macrophages and activated B cells. Upon ligand binding, 4-1BB is associated with the tumor necrosis factor receptor–associated factors (TRAFs), the adaptor protein which mediates downstream signaling events including the activation of NF-kappaB and cytokine production. 4-1BB signaling either by binding to 4-1BBL or by antibody ligation delivers signals for T-cell activation and growth, as well as monocyte proliferation and B-cell survival, and plays an important role in the amplification of T cell-mediated immune responses. In addition, CD137 and CD137L are expressed in different human primary tumor tissues, suggesting that they may influence the progression of tumors. Crosslinking of CD137 on activated T cells has shown promise in enhancing anti-tumor immune responses in murine models, and agonistic anti-CD137 antibodies are currently being tested in phase I clinical trials. Soluble forms of CD137 (sCD137) are generated by differential splicing. sCD137 can bind to CD137 ligand to antagonize the costimulatory activities of the membrane-bound CD137 and reduce T cell proliferation and IL-2 secretion.
Full Name
tumor necrosis factor receptor superfamily, member 9
Research Areas
References
  • Sica G, et al. (1999) Biochemical and immunological characteristics of 4-1BB (CD137) receptor and ligand and potential applications in cancer therapy. Arch Immunol Ther Exp (Warsz). 47(5): 275-9.
  • Nam KO, et al. (2005) The therapeutic potential of 4-1BB (CD137) in cancer. Curr Cancer Drug Targets. 5(5): 357-63.
  • Wang Q, et al. (2008) Analysis of CD137 and CD137L expression in human primary tumor tissues. Croat Med J. 49(2): 192-200.
  • Melero I, et al. (2008) Multi-layered action mechanisms of CD137 (4-1BB)-targeted immunotherapies. Trends Pharmacol Sci. 29(8): 383-90.
  • Thum E, et al. (2009) CD137, implications in immunity and potential for therapy. Front Biosci. 14: 4173-88.

CD137 cDNA ORF Clone, Rabbit, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait