CIRH1A/Cirhin cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

CIRH1A/Cirhin cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2061 bp
Description
Full length Clone DNA of Human cirrhosis, autosomal recessive 1A (cirhin).
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CIRH1A/Cirhin cDNA ORF Clone, Human, untagged: Alternative Names

CIRHIN cDNA ORF Clone, Human; NAIC cDNA ORF Clone, Human; TEX292 cDNA ORF Clone, Human; UTP4 cDNA ORF Clone, Human

CIRH1A/Cirhin Background Information

Full Name
cirrhosis, autosomal recessive 1A (cirhin)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait