After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human F10 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000504.3
cDNA 크기:1461bp
cDNA 설명:Full length Clone DNA of Homo sapiens coagulation factor X.
유전자 동의어:F10, FX, FXA
:Human
벡터:pCMV/hygro
Plasmid:pCMV-F10
제한 사이트:HindIII + XbaI (5.5kb + 1.46kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 792 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human F10 Gene Plasmid Map
Human F10 / FX Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid on other vectors
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG11076-ACG265260
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG11076-ACR265260
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG11076-ANG265260
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG11076-ANR265260
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11076-CF229890
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid, C-His 태그HG11076-CH229890
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG11076-CM229890
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid, C-HA 태그HG11076-CY229890
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone in cloning vectorHG11076-G88420
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmidHG11076-G-N229890
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG11076-NF229890
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid, N-His 태그HG11076-NH229890
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG11076-NM229890
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid, N-HA 태그HG11076-NY229890
휴먼 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmidHG11076-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Coagulation factor X, also known as FX, F10, Eponym Stuart-Prower factor, and thrombokinase, is an enzyme of the coagulation cascade. It is one of the vitamin K-dependent serine proteases, and plays a crucial role in the coagulation cascade and blood clotting, as the first enzyme in the common pathway of thrombus formation. Factor X deficiency is one of the rarest of the inherited coagulation disorders. FX deficiency among the most severe of the rare coagulation defects, typically including hemarthroses, hematomas, and umbilical cord, gastrointestinal, and central nervous system bleeding. Factor X is synthesized in the liver as a mature heterodimer formed from a single-chain precursor, and vitamin K is essential for its synthesis. Factor X is activated into factor Xa (FXa) by both factor IX (with its cofactor, factor VIII in a complex known as intrinsic Xase) and factor VII (with its cofactor, tissue factor in a complex known as extrinsic Xase) through cleaving the activation propeptide. As the first member of the final common pathway or thrombin pathway, FXa converts prothrombin to thrombin in the presence of factor Va, Ca2+, and phospholipid during blood clotting and cleaves prothrombin in two places (an arg-thr and then an arg-ile bond). This process is optimized when factor Xa is complexed with activated cofactor V in the prothrombinase complex. Inborn deficiency of factor X is very uncommon, and may present with epistaxis (nose bleeds), hemarthrosis (bleeding into joints) and gastrointestinal blood loss. Apart from congenital deficiency, low factor X levels may occur occasionally in a number of disease states. Furhermore, factor X deficiency may be seen in amyloidosis, where factor X is adsorbed to the amyloid fibrils in the vasculature.

참고자료
  • Rosen ED. (2002) Gene targeting in hemostasis. Factor X. Front Biosci. 7: d1915-25.
  • Uprichard J, et al. (2002) Factor X deficiency. Blood Rev. 16(2): 97-110.
  • Borensztajn K, et al. (2008) Factor Xa: at the crossroads between coagulation and signaling in physiology and disease. Trends Mol Med. 14(10): 429-40.
  • Menegatti M, et al. (2009) Factor X deficiency. Semin Thromb Hemost. 35(4): 407-15.
  • Size / Price
    Cat No: HG11076-G-N
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human F10 / FX Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".