GCSH cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

GCSH cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
522 bp
Description
Full length Clone DNA of Human glycine cleavage system protein H (aminomethyl carrier).
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GCSH cDNA ORF Clone, Human, untagged: Alternative Names

GCE cDNA ORF Clone, Human; NKH cDNA ORF Clone, Human

GCSH Background Information

Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). GCSH is the H protein, which transfers the methylamine group of glycine from the P protein to the T protein. Defects in GCSH gene are a cause of nonketotic hyperglycinemia (NKH). Two transcript variants, one protein-coding and the other probably not protein-coding,have been found for GCSH gene. Also, several transcribed and non-transcribed pseudogenes of GCSH gene exist throughout the genome.
Full Name
glycine cleavage system protein H (aminomethyl carrier)
References
  • Hiraga K. et al., 1988, Biochem Biophys Res Commun. 151 (2): 758-62.
  • Fujiwara K. et al., 1991, Biochem Biophys Res Commun. 176 (2): 711-6.
  • Koyata H. et al., 1991, Am J Hum Genet. 48 (2): 351-61.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait