HDAC11 cDNA ORF Clone, Human, C-OFPSpark® tag

Price:
Size:
Number:

HDAC11 cDNA ORF Clone, Human, C-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1044 bp
Description
Full length Clone DNA of Human histone deacetylase 11 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HDAC11 cDNA ORF Clone, Human, C-OFPSpark® tag: Alternative Names

HD11 cDNA ORF Clone, Human

HDAC11 Background Information

Histone deacetylases (HDACs) are enzymes that regulate protein functions by catalyzing the removal of acetyl and acyl groups from lysine residues, which play pivotal roles in governing cell behaviors. HDAC11 knockout mice are resistant to high-fat diet-induced obesity and metabolic syndrome, suggesting that HDAC11 functions as a crucial metabolic regulator. HDAC11 as a novel regulator of obesity, with potentially important implications for obesity-related disease treatment. HDAC11 has therapeutic potential for treating diabetes mellitus-associated cardiac injury. Histone deacetylases (HDACs) are involved in multiple physical and pathological processes in classical Hodgkin lymphoma (cHL). HDAC11 was initially identified as a negative regulator of the well-known anti-inflammatory cytokine IL-1.
Full Name
histone deacetylase 11
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait