HDAC11 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

HDAC11 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1044 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human histone deacetylase 11.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI(two restriction sites) + XbaI(6.1kb+0.91kb+0.13kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HDAC11 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HDAC11 cDNA ORF Clone, Human, untagged: Validated Images

HDAC11 cDNA ORF Clone, Human, untagged: Alternative Names

HD11 cDNA ORF Clone, Human

HDAC11 Background Information

Histone deacetylases (HDACs) are enzymes that regulate protein functions by catalyzing the removal of acetyl and acyl groups from lysine residues, which play pivotal roles in governing cell behaviors. HDAC11 knockout mice are resistant to high-fat diet-induced obesity and metabolic syndrome, suggesting that HDAC11 functions as a crucial metabolic regulator. HDAC11 as a novel regulator of obesity, with potentially important implications for obesity-related disease treatment. HDAC11 has therapeutic potential for treating diabetes mellitus-associated cardiac injury. Histone deacetylases (HDACs) are involved in multiple physical and pathological processes in classical Hodgkin lymphoma (cHL). HDAC11 was initially identified as a negative regulator of the well-known anti-inflammatory cytokine IL-1.
Full Name
histone deacetylase 11
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait