SULT1A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

1/1
Price:
Size:
Number:

SULT1A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
927 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 192T/C,201A/G,639G/C not causing the amino acid variation.
Description
Full length Clone DNA of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + XbaI(6kb+0.93kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SULT1A1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SULT1A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Validated Images

SULT1A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

HAST1/HAST2 cDNA ORF Clone, Human; P-PST cDNA ORF Clone, Human; PST cDNA ORF Clone, Human; ST1A1 cDNA ORF Clone, Human; ST1A3 cDNA ORF Clone, Human; STP cDNA ORF Clone, Human; STP1 cDNA ORF Clone, Human; TSPST1 cDNA ORF Clone, Human

SULT1A1 Background Information

Sulfate conjugation catalyzed by cytosolic sulfotransferase (SULT) enzymes. The SULTs are Phase II drug-metabolizing enzymes that catalyze the addition of a sulfuryl moiety to both endogenous compounds, including steroids and neurotransmitters, and certain xenobiotics, including N-hydroxy-2-acetylaminoflourine and phenolic compounds, like alpha-naphthol. SULTs may be involved in the individual genetic disposition, species differences, and organotropisms for toxicological effects of chemicals. Particularly SULT1A1 (Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1), a member of the sulfotransferase 1 subfamily, which is a major pathway for drug metabolism in humans. Humans have at least 1 functional SULT genes. There has been an explosion in information on sulfotransferase polymorphisms and their functional consequences. An Arg213His polymorphism in SULT1A1 has a strong influence on the level of enzyme protein and activity in platelets, which have been widely used for phenotyping. Statistically significant associations were observed between the SULT1A1 genotype (Arg213His) and age, obesity and certain neoplasias (mammary, pulmonary, esophageal and urothelial cancer). Furthermore, the polymorphism of the SULT1A1 may be closely associated with breast cancer.
Full Name
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1
References
  • Coughtrie MW. 2002. Sulfation through the looking glass--recent advances in sulfotransferase research for the curious. Pharmacogenomics J. 2(5): 297-308.
  • Klaassen CD, et al. (1998) Regulation of sulfotransferase mRNA expression in male and female rats of various ages. Chem Biol Interact. 109(1-3): 299-313.
  • Glatt H. (2000) Sulfotransferases in the bioactivation of xenobiotics. Chem Biol Interact. 129(1-2): 141-70.
  • Glatt H, et al. (2004) Pharmacogenetics of soluble sulfotransferases (SULTs). Naunyn Schmiedebergs Arch Pharmacol. 369(1): 55-68.
  • Hebbring SJ, et al. (2008) Sulfotransferase gene copy number variation: pharmacogenetics and function. Cytogenet Genome Res. 123(1-4): 205-10.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait