Syndecan-4 cDNA ORF Clone, Human, N-HA tag

1/1
Price:
Size:
Number:

Syndecan-4 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
597 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human syndecan 4 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + NotI (6kb + 0.63kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Syndecan-4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Syndecan-4 cDNA ORF Clone, Human, N-HA tag: Validated Images

Syndecan-4 cDNA ORF Clone, Human, N-HA tag: Alternative Names

SYND4 cDNA ORF Clone, Human

Syndecan-4 Background Information

SDC4 (Syndecan-4), also known as Syn4, is a transmembrane heparan sulfate proteoglycan that co-operates with integrins during cell-matrix interactions for the assembly of focal adhesions and actin stress fibers and in the phosphorylation of focal adhesion kinase (FAK) on Tyr397. Syndecan-4 plays roles in the formation of focal adhesions and stress fibers. The cytoplasmic domain of syndecan-4 interacts with a number of signalling and structural proteins, and both extracellular and cytoplasmic domains are necessary for regulated activation of associated transmembrane receptors. Syndecan-4/SDC4 is a heparan sulfate proteoglycan and works as a coreceptor for various growth factors. SDC4 deficiency limits neointimal formation after vascular injury by regulating vascular smooth muscle cells (VSMCs) proliferation and vascular progenitor cells (VPCs) mobilization. Therefore, SDC4 may be a novel therapeutic target for preventing arterial restenosis after angioplasty.
Full Name
syndecan 4
References
  • Ikesue M, et al. (2011) Syndecan-4 deficiency limits neointimal formation after vascular injury by regulating vascular smooth muscle cell proliferation and vascular progenitor cell mobilization. Arterioscler Thromb Vasc Biol. 31(5): 1066-74.
  • Saoncella S, et al. (2004) Syndecan-4 regulates ATF-2 transcriptional activity in a Rac1-dependent manner. J Biol Chem. 279(45): 47172-6.
  • Bass MD, et al. (2002) Cytoplasmic interactions of syndecan-4 orchestrate adhesion receptor and growth factor receptor signalling. Biochem J. 368(Pt 1): 1-15.
  • Couchman JR, et al. (1999) Syndecan-4 and integrins: combinatorial signaling in cell adhesion. J Cell Sci. 112 ( Pt 20): 3415-20.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait