TIM-3 cDNA ORF Clone, Human, N-HA tag

1/2
Price:
Size:
Number:

TIM-3 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
906 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human hepatitis A virus cellular receptor 2 (HAVCR2) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + NotI (6kb + 0.93kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TIM-3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TIM-3 cDNA ORF Clone, Human, N-HA tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-HA Tag monoclonal antibody (100028-MM10) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

TIM-3 cDNA ORF Clone, Human, N-HA tag: Alternative Names

CD366 cDNA ORF Clone, Human; HAVcr-2 cDNA ORF Clone, Human; HAVCR2 cDNA ORF Clone, Human; KIM-3 cDNA ORF Clone, Human; Tim-3 cDNA ORF Clone, Human; TIM3 cDNA ORF Clone, Human; TIMD-3 cDNA ORF Clone, Human; TIMD3 cDNA ORF Clone, Human

TIM-3 Background Information

Hepatitis A virus cellular receptor 2 (HAVCR2), formerly known as T cell immunoglobulin and mucin domain-3 (TIM-3), is a transmembrane glycoprotein expressed on the surface of terminally differentiated Th1 cells but not on Th2 cells. It was the first surface molecule that specifically identifies Th1 cells in both mice and human. Recently, identification of Galectin-9 as a ligand for TIM-3 has established the TIM-3-Galectin-9 pathway as an important regulator of Th1 immunity and tolerance induction. Engagement of Tim-3 by its ligand galectin-9 negatively regulates IFN-gamma secretion and influences the ability to induce T cell tolerance in both mice and man. It suggests a novel paradigm in which dysregulation of the TIM-3-galectin-9 pathway could underlie chronic autoimmune disease states, such as multiple sclerosis. Recent work has explored the role of TIM-3 in systemic lupus erythematosus (SLE), and their results indicate that TIM-3 may represent a novel target for the treatment of SLE. Numerous studies have demonstrated that Tim-3 influences autoimmune diseases, including diabetes and multiple sclerosis, and its role in other inflammatory diseases including allergies and cancer is beginning to become clear. In tumor rejection model, soluble form of Tim-3 (sTim-3) significantly impaired T cell antitumor immunity, evidenced by decreased antitumor CTL activity and reduced amount of tumor-infiltrating lymphocytes in tumor. sTim-3 as an immunoregulatory molecule that may be involved in the negative regulation of T cell-mediated immune response.
Full Name
hepatitis A virus cellular receptor 2
References
  • Geng H, et al. (2006) Soluble form of T cell Ig mucin 3 is an inhibitory molecule in T cell-mediated immune response. J Immunol. 176(3): 1411-20.
  • Anderson AC, et al. (2006) TIM-3 in autoimmunity. Curr Opin Immunol. 18(6): 665-9.
  • Anderson DE. (2007) TIM-3 as a therapeutic target in human inflammatory diseases. Expert Opin Ther Targets. 11(8): 1005-9.
  • Pan HF, et al. (2010) TIM-3 as a new therapeutic target in systemic lupus erythematosus. Mol Biol Rep. 37(1): 395-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait