GABA-transaminase/ABAT cDNA ORF Clone, Mouse, C-OFPSpark® tag

Price:
Size:
Number:

GABA-transaminase/ABAT cDNA ORF Clone, Mouse, C-OFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1503 bp
Description
Full length Clone DNA of Mouse 4-aminobutyrate aminotransferase with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GABA-transaminase/ABAT cDNA ORF Clone, Mouse, C-OFPSpark® tag: Alternative Names

9630038C02Rik cDNA ORF Clone, Mouse; AI255750 cDNA ORF Clone, Mouse; ENSMUSG00000051226 cDNA ORF Clone, Mouse; Gabaat cDNA ORF Clone, Mouse; Gabat cDNA ORF Clone, Mouse; Gm9851 cDNA ORF Clone, Mouse; I54 cDNA ORF Clone, Mouse; Laibat cDNA ORF Clone, Mouse; X61497 cDNA ORF Clone, Mouse
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait