ABHD17A cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

ABHD17A cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
933 bp
Description
Full length Clone DNA of Mouse abhydrolase domain containing 17A.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ABHD17A cDNA ORF Clone, Mouse, untagged: Alternative Names

1700013O15Rik cDNA ORF Clone, Mouse; BC005632 cDNA ORF Clone, Mouse; D10Bwg1364e cDNA ORF Clone, Mouse; Fam108a cDNA ORF Clone, Mouse

ABHD17A Background Information

Full Name
abhydrolase domain containing 17A
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait