alk5 cDNA ORF Clone, Mouse, C-HA tag

1/1
Price:
Size:
Number:

alk5 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1554 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse transforming growth factor, beta receptor I with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI(two restriction sites) + NotI(two restriction sites)(6kb+0.96kb+0.6kb+0.01kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

alk5 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

alk5 cDNA ORF Clone, Mouse, C-HA tag: Validated Images

alk5 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

Alk-5 cDNA ORF Clone, Mouse; ALK5 cDNA ORF Clone, Mouse; AU017191 cDNA ORF Clone, Mouse; TbetaR-I cDNA ORF Clone, Mouse; TbetaRI cDNA ORF Clone, Mouse

alk5 Background Information

Transforming growth factor, beta receptor I, also known as Transforming growth factor-beta receptor type I , Serine / threonine-protein kinase receptor R4, Activin receptor-like kinase 5, SKR4, ALK-5, and TGFBR1, is a single-pass type I membrane protein which belongs to the protein kinase superfamily and TGFB receptor subfamily. TGFBR1 / ALK-5 is found in all tissues examined. It is most abundant in placenta and least abundant in brain and heart. TGF-beta functions as a tumor suppressor by inhibiting the cell cycle in the G1 phase. Administration of TGF-beta is able to protect against mammary tumor development in transgenic mouse models in vivo. Disruption of the TGF-beta/SMAD pathway has been implicated in a variety of human cancers, with the majority of colon and gastric cancers being caused by an inactivating mutation of TGF-beta RII. On ligand binding, TGFBR1 / ALK-5 forms a receptor complex consisting of two type I I and two type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which auto-phosphorylate, then bind and activate SMAD transcriptional regulators. TGF-beta signaling via TGFBR1 / ALK-5 is not required in myocardial cells during mammalian cardiac development, but plays an irreplaceable cell-autonomous role regulating cellular communication, differentiation and proliferation in endocardial and epicardial cells. Defects in TGFBR1 / ALK-5 are the cause of Loeys-Dietz syndrome type 1A (LDS1A), Loeys-Dietz syndrome type 2A (LDS2A), and aortic aneurysm familial thoracic type 5 (AAT5).
Full Name
transforming growth factor, beta receptor 1
References
  • Seki T, et al. (2006) Nonoverlapping expression patterns of ALK1 and ALK5 reveal distinct roles of each receptor in vascular development. Lab Invest. 86(2): 116-29. et al.
  • Piek E, et al. (1999) TGF-(beta) type I receptor/ALK-5 and Smad proteins mediate epithelial to mesenchymal transdifferentiation in NMuMG breast epithelial cells. J Cell Sci. 112 (24): 4557-68. et al.
  • Dudas M, et al. (2004) Tgf-beta3-induced palatal fusion is mediated by Alk-5/Smad pathway. Dev Biol. 266(1): 96-108.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait