After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

pCMV3-C-HA Negative Control Vector (C-terminal HA-tagged)

데이터시트리뷰관련제품프로토콜
  • Negative control for the pCMV3-C-HA clone.
  • sVector sequence is the same as pCMV3-C-HA, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV3-C-HA-NCV (Negative Control Vector) Physical Map
 
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV3-C-HA-NCV
 Vector Size

6016bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag HA
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV3-C-HA-NCV (Negative Control Vector) Multiple Cloning Sites

Size / Price
Cat No: CV013
정가: 
가격:      (You Save: )
수량:+-
재고정보5 Business days
대량 주문 문의장바구니에 추가
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".