Text Size:AAA

pCMV3-C-Myc Negative Control Vector (C-terminal Myc-tagged)

    데이터시트리뷰관련제품프로토콜
    • Negative control for the pCMV3-C-Myc clone.
    • Vector sequence is the same as pCMV3-C-Myc, but multiple cloning sites are removed.
    • Designed for mammalian expression, stable or transient.
    • Hygromycin resistance gene for selection of stable cell lines.
     
    pCMV3-C-Myc-NCV (Negative Control Vector) Physical Map
     
    Vector Sequence
    Download     
     
    Description
     
     Vector Name pCMV3-C-Myc-NCV
     Vector Size

    6019bp

     Vector Type Mammalian Expression Vector
     Expression Method Constitutive, Stable / Transient
     Promoter CMV
     Antibiotic Resistance Kanamycin
     Selection In Mammalian Cells Hygromycin
     Protein Tag Myc
     Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
     
    Schematic of pCMV3-C-Myc-NCV (Negative Control Vector) Multiple Cloning Sites

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".