Text Size:AAA

pCMV3-SP-N-HA Negative Control Vector (N-terminal HA-tagged)

    데이터시트리뷰관련제품프로토콜
    • Negative control for the pCMV3-SP-N-HA clone.
    • Vector sequence is the same as pCMV3-SP-N-HA, but multiple cloning sites are removed.
    • Designed for mammalian expression, stable or transient.
    • Hygromycin resistance gene for selection of stable cell lines.
     
    pCMV3-SP-N-HA-NCV (Negative Control Vector) Physical Map
     
    Vector Sequence
    Download     
     
    Description
     
     Vector Name pCMV3-SP-N-HA-NCV
     Vector Size

    6061bp

     Vector Type Mammalian Expression Vector
     Expression Method Constitutive, Stable / Transient
     Promoter CMV
     Antibiotic Resistance Kanamycin
     Selection In Mammalian Cells Hygromycin
     Protein Tag HA
     Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
     
    Schematic of pCMV3-SP-N-HA-NCV (Negative Control Vector) Multiple Cloning Sites

    Size / Price
    Cat No: CV021
    정가: 
    가격:      (You Save: )
    수량:+-
    재고정보
    장바구니에 추가대량 주문 문의

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".