pCMV3-untagged Negative Control Vector

  • Negative control for the pCMV3-untagged clone.
  • Vector sequence is the same as pCMV3-untagged, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV3-untagged-NCV (Negative Control Vector) Physical Map
 
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV3-untagged-NCV
 Vector Size

6082bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Ampicillin
 Selection In Mammalian Cells Hygromycin
 Protein Tag None
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV3-untagged-NCV (Negative Control Vector) Multiple Cloning Sites

  • Epidermal growth factor promotes proliferation of dermal papilla cells via Notch signaling pathway
    Author
    Zhang, H;Nan, W;Wang, S;Zhang, T;Si, H;Wang, D;Yang, F;Li, G;
    Year
    2016
    Journal
    Biochimie
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait