pCMV3-untagged

pCMV3-untagged Physical Map
Download sequence
pCMV3-untagged Physical Map

Comments for pCMV3-untagged:

  • • CMV promoter: bases 250-837
  • • Enhancer: bases 838-1445
  • • SV40 early promoter: bases 2357-2726
  • • Hygromycin ORF: bases 2744-3769
  • • pUC origin: bases 4412-5082
  • • Ampicillin ORF: bases 5227-6087

Cloning Sites for ORF Inserting

Cloning Sites for ORF Inserting

Expression Vector pCMV3-untagged Information Description

Vector Name pCMV3–untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constitutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward: T7(TAATACGACTCACTATAGGG); Reverse: BGH(TAGAAGGCACAGTCGAGG)

Mammalian Expression Vectors

More Reagents and Services