ESAM cDNA ORF Clone, Rat, N-Myc tag

Price:
Size:
Number:

ESAM cDNA ORF Clone, Rat, N-Myc tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1185 bp
Description
Full length Clone DNA of Rat endothelial cell adhesion molecule with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ESAM Background Information

Endothelial cell-selective adhesion molecule (ESAM) is a member of JAM family of immunoglobulin superfamily and consists of one V-type and one C2-type immunoglobulin domain, as well as a hydrophobic signal sequence, a single transmembrane region, and a cytoplasmic domain. It is specifically expressed at endothelial tight junctions and on activated platelets. ESAM at endothelial tight junctions participates in the migration of neutrophils through the vessel wall, possibly by influencing endothelial cell contacts. The adaptor protein membrane-associated guanylate kinase MAGI-1 has been identified as an intracellular binding partner of ESAM. Previous studies have indicated that ESAM regulates angiogenesis in the primary tumor growth and endothelial permeability. It suggest that ESAM has a redundant functional role in physiological angiogenesis but serves a unique and essential role in pathological angiogenic processes such as tumor growth.
Full Name
endothelial cell adhesion molecule
References
  • Ishida T, et al. (2003) Targeted disruption of endothelial cell-selective adhesion molecule inhibits angiogenic processes in vitro and in vivo. J Biol Chem. 278(36): 34598-604.
  • Wegmann F, et al. (2004) Endothelial adhesion molecule ESAM binds directly to the multidomain adaptor MAGI-1 and recruits it to cell contacts. Exp Cell Res. 300(1): 121-33.
  • Wegmann F, et al. (2006) ESAM supports neutrophil extravasation, activation of Rho, and VEGF-induced vascular permeability. J Exp Med. 203(7): 1671-7.
  • Hara T, et al. (2009) Endothelial cell-selective adhesion molecule regulates albuminuria in diabetic nephropathy. Microvasc Res. 77(3): 348-55.
  • Cangara HM, et al. (2010) Role of endothelial cell-selective adhesion molecule in hematogeneous metastasis. Microvasc Res. 80(1): 133-41.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait