Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-OFPSpark / RFP tag

1/1
Price:
Size:
Number:

Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-OFPSpark / RFP tag: General Information

Gene
Species
SFTSV
NCBI Ref Seq
RefSeq ORF Size
1569 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+1.57kb)
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SFTSV Non-structural protein cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-OFPSpark / RFP tag: Validated Images

SFTSV Non-structural protein cDNA ORF Clone, SFTSV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait