Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs natural ORF mammalian expression plasmid

Price:
Size:
Number:

Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs natural ORF mammalian expression plasmid: General Information

Gene
Species
SFTSV
NCBI Ref Seq
RefSeq ORF Size
882 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SFTSV Non-structural protein cDNA ORF Clone, SFTSV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait