CELA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

CELA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
801 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus chymotrypsin-like elastase family, member 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CELA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

1810009A17Rik cDNA ORF Clone, Mouse; 1810062B19Rik cDNA ORF Clone, Mouse; Ela-1 cDNA ORF Clone, Mouse; Ela1 cDNA ORF Clone, Mouse; PC-TsF cDNA ORF Clone, Mouse

CELA1 Background Information

Full Name
chymotrypsin like elastase family member 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait