CISD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

CISD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
327 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus CDGSH iron sulfur domain 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CISD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

AU043990 cDNA ORF Clone, Mouse; AW743335 cDNA ORF Clone, Mouse; D10Ertd214e cDNA ORF Clone, Mouse; mitoNEET cDNA ORF Clone, Mouse; Zcd1 cDNA ORF Clone, Mouse

CISD1 Background Information

Mitochondrial dysfunction is thought to play a significant role in neurodegeneration observed in Parkinson's disease (PD), the loss of mitoNEET (CISD1), an iron-sulfur containing protein that regulates mitochondrial bioenergetics, results in mitochondrial dysfunction and loss of striatal dopamine and tyrosine hydroxylase. CDGSH iron sulfur domain 1 (CISD1, also termed mitoNEET), an iron-containing outer mitochondrial membrane protein, negatively regulates ferroptotic cancer cell death. At the cellular level, CISD1 gene expression increased during human adipocyte differentiation in correlation with adipogenic genes.Thus it is a possible role of CISD1 in obesity-associated dysfunctional adipogenesis in human VAT.
Full Name
CDGSH iron sulfur domain 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait