RSK3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag

Price:
Size:
Number:

RSK3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
156 bp
Description
Full length Clone DNA of Rhesus uncharacterized LOC100430026 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RSK3 Background Information

Ribosomal protein S6 kinase alpha-2, also known as 9 kDa ribosomal protein S6 kinase 2, MAP kinase-activated protein kinase 1c, MAPK-activated protein kinase 1c, Ribosomal S6 kinase 3, RSK-3, RPS6KA2 and MAPKAPK1C, is a nucleus protein which belongs to theprotein kinase superfamily, AGC Ser/Thr protein kinase family and S6 kinase subfamily. RPS6KA2 / RSK-3 is expressed in many tissues. Highest expression is in lung and skeletal muscle. The expression of RPS6KA2 reduced proliferation, caused G1 arrest, increased apoptosis, reduced levels of phosphorylated extracellular signal-regulated kinase and altered other cell cycle proteins. RPS6KA2 / RSK-3 contains oneAGC-kinase C-terminal domain and twoprotein kinase domains. It forms a complex with either ERK1 or ERK2 in quiescent cells. It transiently dissociates following mitogenic stimulation. RPS6KA2 / RSK-3 is a serine/threonine kinase that may play a role in mediating the growth-factor and stress induced activation of the transcription factor CREB. RPS6KA1, RPS6KA2, RPS6KB1, RPS6KB2, and PDK1 are involved in several pathways central to the carcinogenic process, including regulation of cell growth, insulin, and inflammation.
Full Name
ribosomal protein S6 kinase, 90kDa, polypeptide 2
References
  • Zhao Y., et al.,(1995), RSK3 encodes a novel pp90rsk isoform with a unique N-terminal sequence: growth factor-stimulated kinase function and nuclear translocation. Mol. Cell. Biol. 15:4353-4363.
  • Mungall A.J., et al., (2003), The DNA sequence and analysis of human chromosome 6.Nature 425:805-811.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait