FAM3C cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

FAM3C cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
684 bp
Description
Full length Clone DNA of Human family with sequence similarity 3, member C
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FAM3C cDNA ORF Clone, Human, untagged: Alternative Names

GS3786 cDNA ORF Clone, Human; ILEI cDNA ORF Clone, Human

FAM3C Background Information

FAM3C, also known as ILEI, is a member of theFAM3 family. It can be detected in resent in most secretory epithelia. FAM3C may be involved in retinal laminar formation. It promotes epithelial to mesenchymal transition. A change in expression of FAM3C has been noted in pancreatic cancer-derived cells. ILEI is overexpressed and/or altered in intracellular localization in multiple human tumors, an event strongly correlated to invasion/EMT, metastasis formation, and survival in human colon and breast cancer.
Full Name
family with sequence similarity 3, member C
References
  • Zhu Y. et al., 2002, Genomics. 80 (2): 144-50.
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Quéméner-Redon S. et al., 2003, Nature. 424 (6945): 157-64.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait