eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, untagged

Price:
Size:
Number:

eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, untagged: General Information

Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1758 bp
Description
Full length Clone DNA of Ferret eukaryotic translation initiation factor 2A, 65kDa.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

eIF2A/eIF2 alpha Background Information

Full Name
eukaryotic translation initiation factor 2A, 65kDa
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait