GLT8D2 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

GLT8D2 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1050 bp
Description
Full length Clone DNA of Human glycosyltransferase 8 domain containing 2
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GLT8D2 cDNA ORF Clone, Human, untagged: Alternative Names

UNQ1901/PRO4347 cDNA ORF Clone, Human

GLT8D2 Background Information

GLT8D2 is a glycosyltransferase of apoB1 that regulates apoB1 levels in hepatocytes. GLT8D2 expression increased in steatosis HepG2 cells compared with that in normal HepG2 cells. GLT8D2 participated in nonalcoholic fatty liver disease (NAFLD) pathogenesis possibly by negatively regulating MTP expression.
Full Name
glycosyltransferase 8 domain containing 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait