DNase II cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

DNase II cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1083 bp
Description
Full length Clone DNA of Human deoxyribonuclease II, lysosomal with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DNase II cDNA ORF Clone, Human, C-His tag: Alternative Names

DNASE2A cDNA ORF Clone, Human; DNL cDNA ORF Clone, Human; DNL2 cDNA ORF Clone, Human

DNase II Background Information

Full Name
deoxyribonuclease II, lysosomal
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait