Text Size:AAA

인플루엔자 A H10N8 (A/duck/Guangdong/E1/2012) 핵단백질(NP) ORF mammalian expression plasmid (Codon Optimized)

  • Influenza A H10N8 (A/duck/Guangdong/E1/2012) Nucleoprotein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
데이터시트리뷰관련제품프로토콜
 NP cDNA 클론 제품 정보
Gene_bank_ref_id:
cDNA 크기:1497 bp
cDNA 설명:Full length Clone DNA of Influenza A H10N8 (A/duck/Guangdong/E1/2012) Nucleoprotein / NP.
유전자 동의어:NP
:H10N8
벡터:pCMV3-untagged
Plasmid:pCMV3-H10N8-DG-12-NP
제한 사이트:KpnI + XbaI (6.1kb + 1.5kb)
태그 씨퀀스:
염기서열 설명:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AFJ19057.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
 NP Gene Plasmid Map
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Nucleoprotein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
인플루엔자 A H10N8 (A/duck/Guangdong/E1/2012) 핵단백질(NP) ORF mammalian expression plasmid (Codon Optimized) on other vectors
Product nameProduct name
Size / Price
Cat No: VG40353-UT
정가: 
가격:      (You Save: )

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".