MCM5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

MCM5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2205 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae).
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

MCM5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

AA617332 cDNA ORF Clone, Mouse; AI324988 cDNA ORF Clone, Mouse; AL033333 cDNA ORF Clone, Mouse; Cdc46 cDNA ORF Clone, Mouse; Mcmd5 cDNA ORF Clone, Mouse; P1-CDC46 cDNA ORF Clone, Mouse

MCM5 Background Information

Full Name
minichromosome maintenance complex component 5
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait