Text Size:AAA

쥐 GSTM7 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그

    데이터시트리뷰관련제품프로토콜
     GSTM7 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_026672.2
    cDNA 크기:657bp
    cDNA 설명:Full length Clone DNA of Mus musculus glutathione S-transferase, mu 7 with N terminal OFPSpark / RFP tag.
    유전자 동의어:Cd203c, AI894236, 0610005A07Rik
    :Mouse
    벡터:pCMV3-N-OFPSpark
    Plasmid:
    제한 사이트:
    태그 씨퀀스:OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    OFP (OFPSpark) / RFP Tag Info

    OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".