OXNAD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

OXNAD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
936 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus oxidoreductase NAD-binding domain containing 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

OXNAD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

2410002F01Rik cDNA ORF Clone, Mouse; AW492292 cDNA ORF Clone, Mouse; BC019806 cDNA ORF Clone, Mouse

OXNAD1 Background Information

Full Name
oxidoreductase NAD-binding domain containing 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait