SERPINA3M Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

SERPINA3M Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1257 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade A, member 3M.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

SERPINA3M Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

3e46 cDNA ORF Clone, Mouse; AI195004 cDNA ORF Clone, Mouse; MMCM7 cDNA ORF Clone, Mouse; MMSPi2.4 cDNA ORF Clone, Mouse; Spi-2l cDNA ORF Clone, Mouse; Spi-2rs1 cDNA ORF Clone, Mouse; spi2 cDNA ORF Clone, Mouse; Spi2-rs1 cDNA ORF Clone, Mouse; Spi2.4 cDNA ORF Clone, Mouse

SERPINA3M Background Information

Full Name
serine (or cysteine) peptidase inhibitor, clade A, member 3M
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait