TCAF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

TCAF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2769 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus TRPM8 channel-associated factor 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

TCAF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

2810407D09Rik cDNA ORF Clone, Mouse; 3321401G04Rik cDNA ORF Clone, Mouse; A230020K05Rik cDNA ORF Clone, Mouse; AI848529 cDNA ORF Clone, Mouse; Fam115a cDNA ORF Clone, Mouse

TCAF1 Background Information

Full Name
TRPM8 channel-associated factor 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait