Text Size:AAA

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-OFPSpark / RFP 태그

데이터시트리뷰관련제품프로토콜
WNV WNV-C cDNA 클론 제품 정보
Gene_bank_ref_id:DQ211652.1
cDNA 크기:315bp
cDNA 설명:Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C with C terminal OFPSpark / RFP tag.
유전자 동의어:WNV-C
:WNV
벡터:pCMV3-C-OFPSpark
Plasmid:
제한 사이트:
태그 씨퀀스:OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence DQ211652.1 (97..411), corresponding to amino acid sequence YP_001527878.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
OFP (OFPSpark) / RFP Tag Info

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-OFPSpark / RFP 태그 on other vectors
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-GFPSpark 태그VG40344-ACG383160
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-OFPSpark / RFP 태그VG40344-ACR383160
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-GFPSpark 태그VG40344-ANG383160
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-OFPSpark / RFP 태그VG40344-ANR383160
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40344-CF347790
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-His 태그VG40344-CH347790
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-Myc 태그VG40344-CM347790
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-HA 태그VG40344-CY347790
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid (Codon Optimized)VG40344-G112000
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-Flag 태그VG40344-NF347790
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-His 태그VG40344-NH347790
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-Myc 태그VG40344-NM347790
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-HA 태그VG40344-NY347790
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C natural ORF mammalian expression plasmidVG40344-UT347790
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: VG40344-ACR
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
대량 주문 문의장바구니에 추가
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".