pCMV3-N-OFPSpark® Vector

pCMV3-N-OFPSpark® Physical Map

pCMV3-N-OFPSpark® Physical Map Comments for pCMV3-N-OFPSpark®:
• CMV promoter: bases 250-837
• Enhancer: bases 838-1385
• SV40 early promoter: bases 2927-3296
• Hygromycin ORF: bases 3314-4339
• pUC origin: bases 4982-5655
• Kanamycin ORF: bases 5729-6544

Cloning Sites for ORF Inserting

Cloning Sites for ORF Inserting

Expression Vector pCMV3-N-OFPSpark® Information Description

Vector Name pCMV3-N-OFPSpark®
Vector Size 6686bp
Vector Type Mammalian Expression Vector
Expression Method Constitutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag OFPSpark®
Sequencing Primer Forward: T7(TAATACGACTCACTATAGGG); Reverse: BGH(TAGAAGGCACAGTCGAGG)

OFPSpark® Tag Information

OFPSpark® is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark® is more than twice brighter than mOrange2. Fast OFPSpark® maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection.

OFPSpark® can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark® expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark® performs well in some fusions and protein labeling applications.