CD11c/ITGAX cDNA ORF Clone, Mouse, untagged

1/1
Price:
Size:
Number:

CD11c/ITGAX cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
3510 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 3246A/G not causing the amino acid variation.
Description
Full length Clone DNA of Mouse integrin alpha X
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + NotI(6.1kb+3.51kb)
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD11c/ITGAX cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

More Information About CD11c/ITGAX

Entrez Gene ID

CD11c/ITGAX cDNA ORF Clone, Mouse, untagged: Validated Images

CD11c/ITGAX cDNA ORF Clone, Mouse, untagged: Alternative Names

AI449405 cDNA ORF Clone, Mouse; Cd11c cDNA ORF Clone, Mouse; Cr4 cDNA ORF Clone, Mouse; N418 cDNA ORF Clone, Mouse
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait