Sino Biological - 공식 웹사이트

IL11RA cDNA ORF Clone, Canine, C-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

IL11RA cDNA ORF Clone, Canine, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1173 bp
Description
Full length Clone DNA of Canine interleukin 11 receptor, alpha with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

IL11RA cDNA ORF Clone, Canine, C-DYKDDDDK (Flag®) tag: Alternative Names

IL11RA cDNA ORF Clone, Canine

IL11RA Background Information

Interleukin 11 receptor, alpha subunit (IL11RA/IL-11RA) is a subunit of the interleukin 11 receptor which is a member of the hematopoietic cytokine receptor family. IL11RA/IL-11RA is expressed in a number of cell lines, including the myelogenous leukemia cell line K562, the megakaryocytic leukemia cell line Mo7E, the erythroleukemia cell line TF1, and the osteosarcoma cell lines, MG-63 and Saos-2. It is also expressed in normal and malignant prostate epithelial cell lines. Expression levels are increased in prostate carcinoma. This particular receptor is very similar to ciliary neurotrophic factor, since both contain an extracellular region with a 2-domain structure composed of an immunoglobulin-like domain and a cytokine receptor-like domain. Alternative splicing has been observed at this locus, and three variants encoding two different isoforms have been identified. IL11RA/IL-11RA is a receptor for interleukin-11. The receptor systems for IL6, LIF, OSM, CNTF, IL11 and CT1 can utilize IL6ST for initiating signal transmission. Defects in IL11RA/IL-11RA are a cause of craniosynostosis and dental anomalies (CRSDA). CRSDA is a disorder characterized by craniosynostosis, maxillary hypoplasia, and dental anomalies, including malocclusion, delayed and ectopic tooth eruption, and/or supernumerary teeth. Some patients also display minor digit anomalies, such as syndactyly and/or clinodactyly.
Full Name
interleukin 11 receptor subunit alpha
References
  • Van Leuven F, et al. (1996) Molecular cloning and characterization of the human interleukin-11 receptor alpha-chain gene, IL11RA, located on chromosome 9p13. Genomics. 31 (1): 65-70.
  • Yoshizaki A, et al. (2006) Expression of interleukin (IL)-11 and IL-11 receptor in human colorectal adenocarcinoma: IL-11 up-regulation of the invasive and proliferative activity of human colorectal carcinoma cells. Int J Oncol. 29 (4): 869-76.
  • Karube K, et al. (2006) Gene expression profile of cytokines and chemokines in microdissected primary Hodgkin and Reed-Sternberg (HRS) cells: high expression of interleukin-11 receptor alpha. Ann Oncol. 17 (1): 110-6.

IL11RA cDNA ORF Clone, Mouse, Related Products

IL11RA cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait