TROY cDNA ORF Clone, Canine, N-HA tag

Price:
Size:
Number:

TROY cDNA ORF Clone, Canine, N-HA tag: General Information

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1248 bp
Description
Full length Clone DNA of Canine tumor necrosis factor receptor superfamily, member 19 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TROY Background Information

Tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), also known as TAJ-alpha or TROY, is a member of the TNF-receptor superfamily. TNFRSF19/TROY expression is detected in the pulmonary epithelium and the ductal epithelium of the prostate and parotid glands. TNFRSF19/TROY expression is detected in some adenocarcinoma cell lines that arise from this tissue. It has been shown to interact with TRAF family members, and to activate JNK signaling pathway when overexpressed in cells. TNFRSF19/TROY is capable of inducing apoptosis by a caspase-independent mechanism, and it is thought to play an essential role in embryonic development. TNFRSF19/TROY was negatively regulated by adipogenic transcription factor CCAAT/enhancer-binding proteins (C/EBP). TNFRSF19 signals activation of the Jnk pathway and induces cell death. Overexpression of TNFRSF19 also signals NFB activation, comparable and similar to that by p75NGFR. TNFRSF19/TROY is capable of activating key signaling pathways of the TNF receptor family, and its predominant expression patterns suggest that it plays a role in the growth and regulation of epithelial tissues.
Full Name
tumor necrosis factor receptor superfamily, member 19
References
  • Hu S, et al. (1999) Characterization of TNFRSF19, a novel member of the tumor necrosis factor receptor superfamily. Genomics. 62(1): 103-7.
  • Qiu W, et al. (2010) Tumor necrosis factor receptor superfamily member 19 (TNFRSF19) regulates differentiation fate of human mesenchymal (stromal) stem cells through canonical Wnt signaling and C/EBP. J Biol Chem. 285(19): 14438-49.
  • Hisaoka T, et al. (2006) Characterization of TROY/TNFRSF19/TAJ-expressing cells in the adult mouse forebrain. Brain Res. 1110(1): 81-94.

TROY cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait