Chikungunya virus (CHIKV) (strain SL-CK1) E2 glycoprotein Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized)

Price:
Size:
Number:

Chikungunya virus (CHIKV) (strain SL-CK1) E2 glycoprotein Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized): General Information

Gene
Species
CHIKV
RefSeq ORF Size
1275 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with HM045801.1.
Description
Full length Clone DNA of Chikungunya virus (CHIKV), strain SL-CK1 glycoprotein E2.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CHIKV E2 glycoprotein cDNA ORF Clone, CHIKV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.