Dengue virus DENV-2 (strain New Guinea C) NS1 Gene ORF cDNA clone expression plasmid, C-HA tag

Price:
Size:
Number:

Dengue virus DENV-2 (strain New Guinea C) NS1 Gene ORF cDNA clone expression plasmid, C-HA tag: General Information

Gene
Species
DENV
NCBI Ref Seq
RefSeq ORF Size
1056 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of DENV-2 (strain New Guinea C) NS1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Citation List

Dengue virus DENV-2 (strain New Guinea C) NS1 Gene ORF cDNA clone expression plasmid, C-HA tag: Synonyms

DENV-NS1 cDNA ORF Clone, DENV

DENV-NS1 cDNA ORF Clone, DENV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.