Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 Gene ORF cDNA clone expression plasmid, C-HA tag

Price:
Size:
Number:

Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 Gene ORF cDNA clone expression plasmid, C-HA tag: General Information

Gene
Species
DENV
RefSeq ORF Size
1056 bp
Description
Full length Clone DNA of Dengue virus 1 (DENV1) (strain US/Hawaii/1944) DENV-NS1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 Gene ORF cDNA clone expression plasmid, C-HA tag: Synonyms

DENV-NS1 cDNA ORF Clone, DENV

DENV-NS1 cDNA ORF Clone, DENV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.