Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag

Price:
Size:
Number:

Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag: General Information

Gene
Species
DENV
RefSeq ORF Size
1056 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Dengue virus 4 (DENV4) (strain Philippines/H241/1956) DENV-NS1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag: Synonyms

DENV-NS1 cDNA ORF Clone, DENV

DENV-NS1 cDNA ORF Clone, DENV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.