Dengue virus DENV-2 (strain New Guinea C) NS2A Gene ORF cDNA clone expression plasmid, C-OFPSpark / RFP tag

Price:
Size:
Number:

Dengue virus DENV-2 (strain New Guinea C) NS2A Gene ORF cDNA clone expression plasmid, C-OFPSpark / RFP tag: General Information

Gene
Species
DENV
NCBI Ref Seq
RefSeq ORF Size
654 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence AF038403.1 (3478..4131), corresponding to amino acid sequence AAC59275.1 (aa 1128-1345).
Description
Full length Clone DNA of DENV-2 (strain New Guinea C) NS2A with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DENV-NS2A cDNA ORF Clone, DENV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.